Review



fear conditioning apparatus act-100a  (Coulbourn Instruments)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 90
      Buy from Supplier

    Structured Review

    Coulbourn Instruments fear conditioning apparatus act-100a
    Fear Conditioning Apparatus Act 100a, supplied by Coulbourn Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/act-100a/fear+conditioning+apparatus/pmc11981720-70-8-4
    Average 90 stars, based on 1 article reviews
    fear conditioning apparatus act-100a - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    shRNA:

    Article Title: ARNT2 controls prefrontal somatostatin interneurons mediating affective empathy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ARNT2 floxed genotyping primer: reverse 50- GGATTGATAGATGAGCAGCAAGAA -30 This paper N/A Arnt2 shRNA sequence: CGCTATTATCATGCCATAGAT This paper N/A Control shRNA sequence: CCTAAGGTTAAGTCGCCCTCG VectorBuilder N/A Arnt2 qPCR primer: forward 50- GAAGACG CTGATGTCGGACAAG-30 This paper See Table S4 for qPCR primers N/A Arnt2 qPCR primer: reverse 50- CAGAGTT GTGCCGTGACAGGAA -30 This paper See Table S4 for qPCR primers N/A Recombinant DNA pAAV-CAG-FLEX-jGCaMP8f-WPRE Addgene Plasmid #162382 pAAV-CamKIIa-Cre-GFP IBS virus facility N/A pAAV-CamKIIa-GFP IBS virus facility N/A pAAV-U6-Arnt2 shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-scramble shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-Arnt2 gRNA-Ef1a-MS2/P65/HSF1 VectorBuilder N/A pAAV-CMV-dSaCAS9/VP64 VectorBuilder N/A Software and algorithms FreezeFrame Coulbourn Instruments Cat# ACT-100A Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ Zen lite Zeiss http://www.zwiss.com R/qtl R/qtl package http://www.rqtl.org pCLAMP 11.2 Axon Instruments N/A Doric Neuroscience studio Doric lenses inc. https://neuro.doriclenses.com/ MATLAB R2020a Mathworks mathworks.com/ Fiber photometry analysis (FPA) https://github.com/leomol/FPA N/A Chronux software package http://chronux.org N/A Other Optic fibers 400 mm core, 0.50 NA, ZF 1.25, DFL Newdoon FOC-C-B-400-1.25-0.50-1.5 RHD 32-Channel Recording Headstages Intan technologies Part #C3324 Open Ephys acquisition board Open Ephys N/A 18 Cell Reports 43, 114659, September 24, 2024

    Sequencing:

    Article Title: ARNT2 controls prefrontal somatostatin interneurons mediating affective empathy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ARNT2 floxed genotyping primer: reverse 50- GGATTGATAGATGAGCAGCAAGAA -30 This paper N/A Arnt2 shRNA sequence: CGCTATTATCATGCCATAGAT This paper N/A Control shRNA sequence: CCTAAGGTTAAGTCGCCCTCG VectorBuilder N/A Arnt2 qPCR primer: forward 50- GAAGACG CTGATGTCGGACAAG-30 This paper See Table S4 for qPCR primers N/A Arnt2 qPCR primer: reverse 50- CAGAGTT GTGCCGTGACAGGAA -30 This paper See Table S4 for qPCR primers N/A Recombinant DNA pAAV-CAG-FLEX-jGCaMP8f-WPRE Addgene Plasmid #162382 pAAV-CamKIIa-Cre-GFP IBS virus facility N/A pAAV-CamKIIa-GFP IBS virus facility N/A pAAV-U6-Arnt2 shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-scramble shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-Arnt2 gRNA-Ef1a-MS2/P65/HSF1 VectorBuilder N/A pAAV-CMV-dSaCAS9/VP64 VectorBuilder N/A Software and algorithms FreezeFrame Coulbourn Instruments Cat# ACT-100A Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ Zen lite Zeiss http://www.zwiss.com R/qtl R/qtl package http://www.rqtl.org pCLAMP 11.2 Axon Instruments N/A Doric Neuroscience studio Doric lenses inc. https://neuro.doriclenses.com/ MATLAB R2020a Mathworks mathworks.com/ Fiber photometry analysis (FPA) https://github.com/leomol/FPA N/A Chronux software package http://chronux.org N/A Other Optic fibers 400 mm core, 0.50 NA, ZF 1.25, DFL Newdoon FOC-C-B-400-1.25-0.50-1.5 RHD 32-Channel Recording Headstages Intan technologies Part #C3324 Open Ephys acquisition board Open Ephys N/A 18 Cell Reports 43, 114659, September 24, 2024

    Control:

    Article Title: ARNT2 controls prefrontal somatostatin interneurons mediating affective empathy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ARNT2 floxed genotyping primer: reverse 50- GGATTGATAGATGAGCAGCAAGAA -30 This paper N/A Arnt2 shRNA sequence: CGCTATTATCATGCCATAGAT This paper N/A Control shRNA sequence: CCTAAGGTTAAGTCGCCCTCG VectorBuilder N/A Arnt2 qPCR primer: forward 50- GAAGACG CTGATGTCGGACAAG-30 This paper See Table S4 for qPCR primers N/A Arnt2 qPCR primer: reverse 50- CAGAGTT GTGCCGTGACAGGAA -30 This paper See Table S4 for qPCR primers N/A Recombinant DNA pAAV-CAG-FLEX-jGCaMP8f-WPRE Addgene Plasmid #162382 pAAV-CamKIIa-Cre-GFP IBS virus facility N/A pAAV-CamKIIa-GFP IBS virus facility N/A pAAV-U6-Arnt2 shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-scramble shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-Arnt2 gRNA-Ef1a-MS2/P65/HSF1 VectorBuilder N/A pAAV-CMV-dSaCAS9/VP64 VectorBuilder N/A Software and algorithms FreezeFrame Coulbourn Instruments Cat# ACT-100A Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ Zen lite Zeiss http://www.zwiss.com R/qtl R/qtl package http://www.rqtl.org pCLAMP 11.2 Axon Instruments N/A Doric Neuroscience studio Doric lenses inc. https://neuro.doriclenses.com/ MATLAB R2020a Mathworks mathworks.com/ Fiber photometry analysis (FPA) https://github.com/leomol/FPA N/A Chronux software package http://chronux.org N/A Other Optic fibers 400 mm core, 0.50 NA, ZF 1.25, DFL Newdoon FOC-C-B-400-1.25-0.50-1.5 RHD 32-Channel Recording Headstages Intan technologies Part #C3324 Open Ephys acquisition board Open Ephys N/A 18 Cell Reports 43, 114659, September 24, 2024

    Real-time Polymerase Chain Reaction:

    Article Title: ARNT2 controls prefrontal somatostatin interneurons mediating affective empathy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ARNT2 floxed genotyping primer: reverse 50- GGATTGATAGATGAGCAGCAAGAA -30 This paper N/A Arnt2 shRNA sequence: CGCTATTATCATGCCATAGAT This paper N/A Control shRNA sequence: CCTAAGGTTAAGTCGCCCTCG VectorBuilder N/A Arnt2 qPCR primer: forward 50- GAAGACG CTGATGTCGGACAAG-30 This paper See Table S4 for qPCR primers N/A Arnt2 qPCR primer: reverse 50- CAGAGTT GTGCCGTGACAGGAA -30 This paper See Table S4 for qPCR primers N/A Recombinant DNA pAAV-CAG-FLEX-jGCaMP8f-WPRE Addgene Plasmid #162382 pAAV-CamKIIa-Cre-GFP IBS virus facility N/A pAAV-CamKIIa-GFP IBS virus facility N/A pAAV-U6-Arnt2 shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-scramble shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-Arnt2 gRNA-Ef1a-MS2/P65/HSF1 VectorBuilder N/A pAAV-CMV-dSaCAS9/VP64 VectorBuilder N/A Software and algorithms FreezeFrame Coulbourn Instruments Cat# ACT-100A Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ Zen lite Zeiss http://www.zwiss.com R/qtl R/qtl package http://www.rqtl.org pCLAMP 11.2 Axon Instruments N/A Doric Neuroscience studio Doric lenses inc. https://neuro.doriclenses.com/ MATLAB R2020a Mathworks mathworks.com/ Fiber photometry analysis (FPA) https://github.com/leomol/FPA N/A Chronux software package http://chronux.org N/A Other Optic fibers 400 mm core, 0.50 NA, ZF 1.25, DFL Newdoon FOC-C-B-400-1.25-0.50-1.5 RHD 32-Channel Recording Headstages Intan technologies Part #C3324 Open Ephys acquisition board Open Ephys N/A 18 Cell Reports 43, 114659, September 24, 2024

    Recombinant:

    Article Title: ARNT2 controls prefrontal somatostatin interneurons mediating affective empathy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ARNT2 floxed genotyping primer: reverse 50- GGATTGATAGATGAGCAGCAAGAA -30 This paper N/A Arnt2 shRNA sequence: CGCTATTATCATGCCATAGAT This paper N/A Control shRNA sequence: CCTAAGGTTAAGTCGCCCTCG VectorBuilder N/A Arnt2 qPCR primer: forward 50- GAAGACG CTGATGTCGGACAAG-30 This paper See Table S4 for qPCR primers N/A Arnt2 qPCR primer: reverse 50- CAGAGTT GTGCCGTGACAGGAA -30 This paper See Table S4 for qPCR primers N/A Recombinant DNA pAAV-CAG-FLEX-jGCaMP8f-WPRE Addgene Plasmid #162382 pAAV-CamKIIa-Cre-GFP IBS virus facility N/A pAAV-CamKIIa-GFP IBS virus facility N/A pAAV-U6-Arnt2 shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-scramble shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-Arnt2 gRNA-Ef1a-MS2/P65/HSF1 VectorBuilder N/A pAAV-CMV-dSaCAS9/VP64 VectorBuilder N/A Software and algorithms FreezeFrame Coulbourn Instruments Cat# ACT-100A Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ Zen lite Zeiss http://www.zwiss.com R/qtl R/qtl package http://www.rqtl.org pCLAMP 11.2 Axon Instruments N/A Doric Neuroscience studio Doric lenses inc. https://neuro.doriclenses.com/ MATLAB R2020a Mathworks mathworks.com/ Fiber photometry analysis (FPA) https://github.com/leomol/FPA N/A Chronux software package http://chronux.org N/A Other Optic fibers 400 mm core, 0.50 NA, ZF 1.25, DFL Newdoon FOC-C-B-400-1.25-0.50-1.5 RHD 32-Channel Recording Headstages Intan technologies Part #C3324 Open Ephys acquisition board Open Ephys N/A 18 Cell Reports 43, 114659, September 24, 2024

    Plasmid Preparation:

    Article Title: ARNT2 controls prefrontal somatostatin interneurons mediating affective empathy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ARNT2 floxed genotyping primer: reverse 50- GGATTGATAGATGAGCAGCAAGAA -30 This paper N/A Arnt2 shRNA sequence: CGCTATTATCATGCCATAGAT This paper N/A Control shRNA sequence: CCTAAGGTTAAGTCGCCCTCG VectorBuilder N/A Arnt2 qPCR primer: forward 50- GAAGACG CTGATGTCGGACAAG-30 This paper See Table S4 for qPCR primers N/A Arnt2 qPCR primer: reverse 50- CAGAGTT GTGCCGTGACAGGAA -30 This paper See Table S4 for qPCR primers N/A Recombinant DNA pAAV-CAG-FLEX-jGCaMP8f-WPRE Addgene Plasmid #162382 pAAV-CamKIIa-Cre-GFP IBS virus facility N/A pAAV-CamKIIa-GFP IBS virus facility N/A pAAV-U6-Arnt2 shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-scramble shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-Arnt2 gRNA-Ef1a-MS2/P65/HSF1 VectorBuilder N/A pAAV-CMV-dSaCAS9/VP64 VectorBuilder N/A Software and algorithms FreezeFrame Coulbourn Instruments Cat# ACT-100A Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ Zen lite Zeiss http://www.zwiss.com R/qtl R/qtl package http://www.rqtl.org pCLAMP 11.2 Axon Instruments N/A Doric Neuroscience studio Doric lenses inc. https://neuro.doriclenses.com/ MATLAB R2020a Mathworks mathworks.com/ Fiber photometry analysis (FPA) https://github.com/leomol/FPA N/A Chronux software package http://chronux.org N/A Other Optic fibers 400 mm core, 0.50 NA, ZF 1.25, DFL Newdoon FOC-C-B-400-1.25-0.50-1.5 RHD 32-Channel Recording Headstages Intan technologies Part #C3324 Open Ephys acquisition board Open Ephys N/A 18 Cell Reports 43, 114659, September 24, 2024

    Virus:

    Article Title: ARNT2 controls prefrontal somatostatin interneurons mediating affective empathy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ARNT2 floxed genotyping primer: reverse 50- GGATTGATAGATGAGCAGCAAGAA -30 This paper N/A Arnt2 shRNA sequence: CGCTATTATCATGCCATAGAT This paper N/A Control shRNA sequence: CCTAAGGTTAAGTCGCCCTCG VectorBuilder N/A Arnt2 qPCR primer: forward 50- GAAGACG CTGATGTCGGACAAG-30 This paper See Table S4 for qPCR primers N/A Arnt2 qPCR primer: reverse 50- CAGAGTT GTGCCGTGACAGGAA -30 This paper See Table S4 for qPCR primers N/A Recombinant DNA pAAV-CAG-FLEX-jGCaMP8f-WPRE Addgene Plasmid #162382 pAAV-CamKIIa-Cre-GFP IBS virus facility N/A pAAV-CamKIIa-GFP IBS virus facility N/A pAAV-U6-Arnt2 shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-scramble shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-Arnt2 gRNA-Ef1a-MS2/P65/HSF1 VectorBuilder N/A pAAV-CMV-dSaCAS9/VP64 VectorBuilder N/A Software and algorithms FreezeFrame Coulbourn Instruments Cat# ACT-100A Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ Zen lite Zeiss http://www.zwiss.com R/qtl R/qtl package http://www.rqtl.org pCLAMP 11.2 Axon Instruments N/A Doric Neuroscience studio Doric lenses inc. https://neuro.doriclenses.com/ MATLAB R2020a Mathworks mathworks.com/ Fiber photometry analysis (FPA) https://github.com/leomol/FPA N/A Chronux software package http://chronux.org N/A Other Optic fibers 400 mm core, 0.50 NA, ZF 1.25, DFL Newdoon FOC-C-B-400-1.25-0.50-1.5 RHD 32-Channel Recording Headstages Intan technologies Part #C3324 Open Ephys acquisition board Open Ephys N/A 18 Cell Reports 43, 114659, September 24, 2024

    Software:

    Article Title: ARNT2 controls prefrontal somatostatin interneurons mediating affective empathy.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER ARNT2 floxed genotyping primer: reverse 50- GGATTGATAGATGAGCAGCAAGAA -30 This paper N/A Arnt2 shRNA sequence: CGCTATTATCATGCCATAGAT This paper N/A Control shRNA sequence: CCTAAGGTTAAGTCGCCCTCG VectorBuilder N/A Arnt2 qPCR primer: forward 50- GAAGACG CTGATGTCGGACAAG-30 This paper See Table S4 for qPCR primers N/A Arnt2 qPCR primer: reverse 50- CAGAGTT GTGCCGTGACAGGAA -30 This paper See Table S4 for qPCR primers N/A Recombinant DNA pAAV-CAG-FLEX-jGCaMP8f-WPRE Addgene Plasmid #162382 pAAV-CamKIIa-Cre-GFP IBS virus facility N/A pAAV-CamKIIa-GFP IBS virus facility N/A pAAV-U6-Arnt2 shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-scramble shRNA-CMV-mCherry VectorBuilder N/A pAAV-U6-Arnt2 gRNA-Ef1a-MS2/P65/HSF1 VectorBuilder N/A pAAV-CMV-dSaCAS9/VP64 VectorBuilder N/A Software and algorithms FreezeFrame Coulbourn Instruments Cat# ACT-100A Graphpad Prism 10 GraphPad Software https://www.graphpad.com/ Zen lite Zeiss http://www.zwiss.com R/qtl R/qtl package http://www.rqtl.org pCLAMP 11.2 Axon Instruments N/A Doric Neuroscience studio Doric lenses inc. https://neuro.doriclenses.com/ MATLAB R2020a Mathworks mathworks.com/ Fiber photometry analysis (FPA) https://github.com/leomol/FPA N/A Chronux software package http://chronux.org N/A Other Optic fibers 400 mm core, 0.50 NA, ZF 1.25, DFL Newdoon FOC-C-B-400-1.25-0.50-1.5 RHD 32-Channel Recording Headstages Intan technologies Part #C3324 Open Ephys acquisition board Open Ephys N/A 18 Cell Reports 43, 114659, September 24, 2024



    Similar Products

    fear conditioning apparatus act-100a  (Coulbourn Instruments)
    90
    Coulbourn Instruments fear conditioning apparatus act-100a
    Fear Conditioning Apparatus Act 100a, supplied by Coulbourn Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/act-100a/fear+conditioning+apparatus/pmc11981720-70-8-4
    Average 90 stars, based on 1 article reviews
    fear conditioning apparatus act-100a - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    act-100a  (Coulbourn Instruments)
    90
    Coulbourn Instruments act-100a
    Act 100a, supplied by Coulbourn Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/act-100a/fear+conditioning+apparatus/pm39180750-722-95-97
    Average 90 stars, based on 1 article reviews
    act-100a - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    sound-attenuating fear-conditioning chamber (act-100a  (Coulbourn Instruments)
    90
    Coulbourn Instruments sound-attenuating fear-conditioning chamber (act-100a
    Sound Attenuating Fear Conditioning Chamber (Act 100a, supplied by Coulbourn Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/act-100a/fear+conditioning+apparatus/pmc09355652-153-8-11
    Average 90 stars, based on 1 article reviews
    sound-attenuating fear-conditioning chamber (act-100a - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    sound-attenuating fear-conditioning chamber act-100a  (Coulbourn Instruments)
    90
    Coulbourn Instruments sound-attenuating fear-conditioning chamber act-100a
    Sound Attenuating Fear Conditioning Chamber Act 100a, supplied by Coulbourn Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/act-100a/fear+conditioning+apparatus/pm35935755-71-8-11
    Average 90 stars, based on 1 article reviews
    sound-attenuating fear-conditioning chamber act-100a - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    automated video-tracking system act-100a  (Coulbourn Instruments)
    90
    Coulbourn Instruments automated video-tracking system act-100a
    Automated Video Tracking System Act 100a, supplied by Coulbourn Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/act-100a/fear+conditioning+apparatus/pmc08590219-72-30-33
    Average 90 stars, based on 1 article reviews
    automated video-tracking system act-100a - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    apparatus act 100a  (Coulbourn Instruments)
    86
    Coulbourn Instruments apparatus act 100a
    Apparatus Act 100a, supplied by Coulbourn Instruments, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/act-100a/coulbourn+inc+instruments/pmc08504953-107-9-9
    Average 86 stars, based on 1 article reviews
    apparatus act 100a - by Bioz Stars, 2026-09
    86/100 stars
    		  Buy from Supplier
    apparatus act-100a  (Coulbourn Instruments)
    90
    Coulbourn Instruments apparatus act-100a
    Apparatus Act 100a, supplied by Coulbourn Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/act-100a/fear+conditioning+apparatus/10__1177_slash_0271678x211006291-97-7-9
    Average 90 stars, based on 1 article reviews
    apparatus act-100a - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    video-based conditioned fear system freezeview act-100a  (Coulbourn Instruments)
    90
    Coulbourn Instruments video-based conditioned fear system freezeview act-100a
    Video Based Conditioned Fear System Freezeview Act 100a, supplied by Coulbourn Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/act-100a/fear+conditioning+apparatus/pm28167116-133-128-122
    Average 90 stars, based on 1 article reviews
    video-based conditioned fear system freezeview act-100a - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier
    freezeview (act-100a  (Coulbourn Instruments)
    90
    Coulbourn Instruments freezeview (act-100a
    Freezeview (Act 100a, supplied by Coulbourn Instruments, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/act-100a/fear+conditioning+apparatus/pm28167116-133-120-122
    Average 90 stars, based on 1 article reviews
    freezeview (act-100a - by Bioz Stars, 2026-09
    90/100 stars
    		  Buy from Supplier

    Image Search Results